MaizeGDB
jobs | upcoming events | sitemap
 | docs | bulk data | browse data | tools | login / register | links 
homeA popup window providing help for using the search form to the right  

Overgo Data In MaizeGDB

Simple Overgo Search | Overgo Sequence Search | Overgo Reports | Discussion of Overgo Data for the General Public


Simple Overgo Search

This search form allows you to just enter basic name info to quickly retrieve the desired overgo. Use % as a wild card.

(see a sample overgo search)

The above search, given as an example, lets you find overgos developed from the 486 library of the Maize Gene Discovery Project. Another interesting sample query would be %486055D02 (which retrieves an overgo designed from a specific member of that 486 library).

From the Maize Mapping Project, you can find overgos prepared by DuPont/Incyte using a search like cl% (combined public/private cluster), pc% (public cluster), or si% (public singleton), which retrieves overgos designed for the project.

This search can be executed on every page on the site by utilizing the form in the upper right corner. Choose "Overgo" from the drop-down menu, enter your search term in the field, and hit return to find the overgo you're looking for.


Overgo Sequence Search

This search form allows you to enter snippets of nucleotide sequence (up to 25 bp) and find all exact matches in the overgo sequences we have.

(see a sample overgo sequence search)

Overgo Reports

Here are some useful summary reports on the overgo data that you might find to be helpful.

Overgo Sequences: A complete list of the overgo sequences we have here. It's very nice if you want to do repeated simple matches using the "Find" tool on your browser, or if you want to just see all of the sequences in summation.


Discussion of Overgo Data for the General Public

What is an overgo?

An overgo is a primer construct designed to pack a lot of label into a short sequence, so that it will serve as a sensitive probe for similar short sequences in genomic DNA. It is based on two partially OVERlapping oliGOnucleotide primers, each of which primes the other in a labeling reaction. For example, let's say you had two primers, one with the sequence TGGATCCTGTGCCTTTTGACATCG and another with the sequence GTCACCAAATCCCTCTCGATGTCA.

In order to visualize how these sequences stick together, it can be useful to look at an alignment of the first primer with the reversed complement of the second. If we take the complement of the second one (remember, DNA is double-stranded, and every G is paired with a C on the other strand, and every A is paired with a T on the other strand), we get the sequence CAGTGGTTTAGGGAGAGCTACAGT. We also need to reverse the order of the letters as part of the process, giving us the sequence TGACATCGAGAGGGATTTGGTGAC.

The original first sequence, TGGATCCTGTGCCTTTTGACATCG, and the reversed complement sequence of the second primer, TGACATCGAGAGGGATTTGGTGAC, have something in common: the last eight characters of the first sequence are exactly the same as the first eight characters of the second!

The resulting genetic element, after combining the two (into TGGATCCTGTGCCTTTTGACATCGAGAGGGATTTGGTGAC), can be used as a probe to detect specific short sequences in the maize genome.

Here's a more clear example of how an overgo is constructed. The original primers are derived from ESTs from the Maize Gene Discovery Project.

Original Primers
======================================
Primer 1: 5' AAAAAAAAATTAGGTGCAAGAGGC 3'
Primer 2: 5' GGAATGGGATTTGCCGGCCTCTTG 3'

After Complementation of Primer 2
=================================
Primer 1: 5' AAAAAAAAATTAGGTGCAAGAGGC 3'
Primer 2: 3' CCTTACCCTAAACGGCCGGAGAAC 5'

After Reversal of Primer 2
==========================
Primer 1: 5' AAAAAAAAATTAGGTGCAAGAGGC 3'
Primer 2: 5' CAAGAGGCCGGCAAATCCCATTCC 3'

Alignment of Primers
====================
Primer 1: 5' AAAAAAAAATTAGGTGCAAGAGGC 3'
                             ||||||||
Primer 2:                 5' CAAGAGGCCGGCAAATCCCATTCC 3'

The non-overlapping regions can be filled in using radioactive oligonucleotides to create a highly radioactive probe!

Summary Overgo Sequence
=======================
Overgo:   5' AAAAAAAAATTAGGTGCAAGAGGCCGGCAAATCCCATTCC 3'


The Resulting Actual Double Stranded Element (Original Primers Shown In BOLD
Radioactively Labelled Nucleotides Shown in PLAIN TEXT)
============================================================================
5' AAAAAAAAATTAGGTGCAAGAGGCCGGCAAATCCCATTCC 3'
3' TTTTTTTTTAATCCACGTTCTCCGGCCGTTTAGGGTAAGG 5'

Overgo probes can be both highly specific and highly radioactive, making them useful in probing BAC clone pools representing large genomes such as maize, or the human genome where they were developed. They are very small (40-mers) typically designed from 3' untranslated cDNA sequence. In the case of the approximately 10,000 maize cDNAs used for Overgo design, some 40% can be aligned to rice genomic sequence (Gramene 2002, www.gramene.org).

Contributed by John Bowers:
Two major advantages of overgos over standard "plasmid" probes are:
1. Hybridization can be carried out under standardized conditions due to standardized probe length and controlled GC content.
2. Overgo probe use makes it possible to select for specifically low or single copy portions of a longer sequence that may contain repetitive parts (which would otherwise result in high levels of background using other probe/hybridization techniques).


Return to the homepage

Last updated 1:49 pm, Dec 03, 2014.

home  

Be sure to cite us!

This page is HTML 4.01 valid!